Note:

Visiting/Using the site requires accepting our privacy policies - Click to accept

Precision Nanomedicine

The official journal of CLINAM

Precision Nanomedicine (PRNANO) is an open-access, not-for-profit journal that promotes all practical, rational and progressive aspects of nanomedicine.

Authors are invited to submit both original and replication studies. Discussions of negative results are also welcome.

2019 SUBMISSIONS ARE FREE - NO APC IN 2019 

PRNANO is digitally distributed by a scientists-owned non-profit publisher: Andover House Inc, 138 River Rd, Massachusetts, 01810, USA. E-ISSN: 2639-9431

Nanoparticle-Encapsulated Doxorubicin Demonstrates Superior Tumor Cell Kill in Triple Negative Breast Cancer Subtypes Intrinsically Resistant to Doxorubicin
- Krausz AE, Adler BL, Makdisi J, Schairer D, Rosen J, Landriscina A, Navati M, Alfieri A, Friedman JM, Nosanchuk JD, Rodriguez-Gabin A, Ye KQ, McDaid HM, Friedman AJ.
Liposomal formulation of polyacrylate-peptide conjugate as a new vaccine candidate against cervical cancer
- Khongkow M, Liu TY, Bartlett S, Hussein WM, Nevagi R, Jia ZF, Monteiro MJ, Wells J, Ruktanonchai UR, Skwarczynski M, Toth I.
Specific Molecular Recognition as a Strategy to Delineate Tumor Margin Using Topically Applied Fluorescence Embedded Nanoparticles
- Barton S, Li B, Siuta M, Janve VA, Song J, Holt CM, Tomono T, Ukawa M, Kumagai H, Tobita E, Wilson K, Sakuma S, Pham W.
Nanotherapy Targeting NF-kappaB Attenuates Acute Pain After Joint Injury
- Yan H, Duan X, Collins KH, Springer LE., Guilak FE, Wickline SA, M. Rai F, Pan H, Pham CTN
Simultaneous release of two drugs from polymer nano-implant inhibits recurrence in glioblastoma spheroids
- Devassy G, Ramachandran R, Jeena K, Junnuthula VR, Gopinatha VK, Manju CA, Manohar M, Nair SV, Raghavan SC, Koyakutty M.
Download PDF Views: 658     Downloads: 129

Rational Design of a siRNA Delivery System: ALOX5 and Cancer Stem Cells as Therapeutic Targets

Research Article

Diana Rafael1,2*, Fernanda Andrade2,3*, Sara Montero2, Petra Gener2,3, Joaquin Seras-Franzoso2, Francesc Martínez2, Patricia González2,3, Helena Florindo1, Diego Arango4, Joan Sayós5, Ibane Abasolo2,3,6, *Mafalda Videira1,[1], and *Simó Schwartz Jr.2,3, [2]

1Research Institute for Medicines and Pharmaceutical Sciences, Faculdade de Farmácia, Universidade de Lisboa (iMed.ULisboa), Lisbon, Portugal

2Drug Delivery and Targeting Group, Molecular Biology and Biochemistry Research Centre for Nanomedicine (CIBBIM-Nanomedicine), Vall d’Hebron Institut de Recerca, Universitat Autònoma de Barcelona, Barcelona, Spain

3Networking Research Centre for Bioengineering, Biomaterials, and Nanomedicine (CIBER-BBN), Instituto de Salud Carlos III, Zaragoza , Spain

4Biomedical Research in Digestive Tract Tumors, CIBBIM-Nanomedicine, Vall d’Hebron Institut de Recerca, Universitat Autònoma de Barcelona, Barcelona, Spain

5Immune Regulation and Immunotherapy, CIBBIM-Nanomedicine, Vall d’Hebron Institut de Recerca, Universitat Autònoma de Barcelona, Barcelona, Spain

6Functional Validation & Preclinical Research (FVPR), CIBBIM-Nanomedicine, Vall d’Hebron Institut de Recerca, Universitat Autònoma de Barcelona, Barcelona, Spain

*These authors contributed equally to this work.

Submitted: June 22, 2018; Accepted: June 29, 2018; Posted July 13, 2018

Abbreviations:

  • ALOX5 Arachidonate 5-lipoxygenase
  • 5-DTAF 5-8[4,6-dichlorotriazin-2-yl]amino)fluorescein hydrochloride
  • AE Association efficiency
  • ALDH1A1 Aldehyde dehydrogenase 1
  • CMT Critical micellar temperature
  • DAPI 4’,6-diamidino-2-phenylindole
  • DD Degree of deacetylation
  • DLS Dynamic light scattering
  • DM Direct Dissolution method
  • EO Ethylene oxide
  • EPR Enhanced permeability and retention effect
  • ERK Extracellular signal–regulated kinases
  • FACS Fluorescence-activated cell sorting
  • FBS Fetal bovine serum
  • FGFR Fibroblast growth factor receptors
  • FH Thin-film hydration
  • GADPH Glyceraldehyde 3-phosphate dehydrogenase
  • GFP Green fluorescent protein
  • MTT 3-(4,5-dimethythiazol-2-yl)-2,5 diphenyl tetrazolium bromide
  • PDI Polydispersity index
  • PO Propylene oxide
  • qRT-PCR Quantitative real time polymerase chain reaction
  • ZP Zeta potential

Keywords:

Polymeric Micelles, Pluronic® F127, Gene Delivery, siRNA, ALOX5, Cancer Stem Cells.

License:

CC BY-NC-SA 4.0.

Abstract

The search for an ideal gene delivery system is a long and laborious process in which several factors from the first idea to final formulation, including main challenges, peaks and troughs, should be deeply taken into consideration to ensure adequate biological safety and in vivo efficacy endpoints. Arachidonate 5-lipoxygenase (ALOX5), a crucial player related with cancer development and in particular with cancer stem cells malignancy. In this work we describe the process behind the development of a small interfering RNA (siRNA) delivery system to inhibit ALOX5 in cancer stem cells (CSC), as a model target gene. We started by screening chitosan polyplexes, among different types of chitosan in different complexation conditions. Due to the low silencing efficacy obtained, chitosan polyplexes were combined with Pluronic®-based polymeric micelles with recognized advantages regarding gene transfection. We tested different types of polymeric particles to improve the biological efficacy of chitosan polyplexes. Nevertheless, limited transfection efficiency was still detected. The well-established polyethylenimine (PEI) cationic polymer was used in substitution of chitosan, in combination with polymeric micelles, originating PEI-siRNA-Pluronic® systems. The presence of Pluronic® F127 in the formulation showed to be of utmost importance, because not only the silencing activity of the polyplexes was improved, but also PEI-associated toxicity was clearly reduced. This, allowed to increase the amount of PEI inside the system and its overall efficacy. Indeed, different types of PEI, N/P ratios and preparation methods were tested until an optimal formulation composed by PEI 10k branched-based polyplexes at an N/P ratio of 50 combined with micelles of Pluronic® F127 was selected. This combined micelle presented adequate technological properties, safety profile and biological efficacy, resulting in high ALOX5 gene silencing and strong reduction of invasion and transformation capabilities of a stem cell subpopulation isolated from MDA-MB-231 triple negative breast cancer cells.

Rationale and Purpose

The design and development of a nanoparticle-based drug delivery system is a long and complex process that is often not reflected in the literature. There are years of backstage work and a wide collection of negative results that are considered not publishable. However, this data gives crucial information for moving forward in the proper direction. Moreover, the publication of negative results, although not usual, is of great importance for time and resources optimization, by avoiding the repetition of similar errors by other research groups and, more importantly, by redefining the work plan priorities. Described in this work is the rational design and experimental sequence beyond the development of a nanocarrier system for siRNA intracellular delivery, with the negative results and the consequent modifications and improvements. The ultimate goal is the development of a new nanotechnology-based approach for cancer treatment.

Introduction

Despite of considerable number of advances achieved in the past decades, clinical use of nucleic acids as gene-based antitumor therapy is still precluded, mainly because of their poor cellular uptake, vulnerability to enzymatic degradation, and rapid renal clearance. Until now, most gene therapy strategies rely on the use of viral vectors, even though their use frequently raises important safety issues, challenging their clinical standardization as gene delivery vectors. Further, several limitations have also been identified in some non-viral vectors, such as low specificity, cellular toxicity, and limited transfection efficiencies (1, 2). Therefore, successful clinical application of gene therapy in the oncology field urgently demands the emergence of new and safer vehicles to first, enable oligonucleotides (OGN) to be effectively delivered into tumor target cells, and second, to overcome the well-known drawbacks of current vehicles (1, 3-6). Moreover, the design of a new vehicle has to take into account that an ideal gene delivery system should be efficient, stable, cost effective, and able to avoid rapid hepatic and renal clearance. Safety issues such as biocompatibility, biodegradability and lack of immunogenicity are also critical, as well as the need of an appropriate balance between protection and release of the genetic material from the endosomes (e.g. proton-sponge effect) in order to ensure biological functionality (1, 7). Other characteristics such as particle size, surface charge, presence of moieties and also their interactions with the tumor environment should be finely tuned in order to improve their biological behavior and efficacy (8, 9). Nanoparticles intended for gene delivery usually possess in its composition cationic polymers, such as chitosan (CS) and polyethylenimine (PEI) that condense negatively charged nucleic acids through electrostatic interactions (2, 10, 11).

CS is a natural cationic polysaccharide composed of glucosamine and N-acetyl glucosamine, whose ability to interact with negatively charged OGN depend, among other factors, on its Molecular Weight (MW) and Deacetylation Degree (DD). Whereas high DD enables better interaction with genetic material, high MW improves stability of the complexes, while low MW ameliorates intracellular release of OGN (12-14). Accordingly, DD and MW of CS should be adequately considered in order to ensure an appropriate balance between protection and release of OGN. In order to improve transfection efficiency of CS-based carriers, different chemical modifications as well as the use of the water-soluble salt forms of CS have been investigated (12, 13, 15-21). Regarding PEI and despite its high transfection efficiency, its use as a delivery vehicle is hampered because of its high cationic charge density (22-24). In fact, the transfection efficiency and cytotoxicity of these polymers are highly dependent on their linear versus branched structure, their branching degree and their MW (23, 25-28). PEI branched forms present higher transfection efficiencies than linear forms. Furthermore, higher MW PEI are frequently associated with higher buffering capacity, higher transfection efficiencies and also with increased cytotoxicity. An adequate ratio between the nitrogen content of the polymer and the number of phosphate groups from the OGN (N/P ratio) should be optimized for each formulation in order to find an equilibrium of charges and to achieve maximal efficacy with minor toxicity (23, 25, 27, 29). Many different strategies have been explored in order to improve the efficiency of PEI transfection by reducing cytotoxicity, avoiding aggregation, and decreasing nonspecific interactions. Among them, grafting PEI with polyethylenglycol (PEG) has become one of the most popular ones (30, 31).

In this study, both CS and PEI polycations have been used in combination with poloxamers (Pluronic®) based micelles (PM) in order to achieve an improvement of their transfection efficiency and toxicity profile, as well as their efficacy against cancer cells. Poloxamers are amphiphilic polymers consisting in ethylene oxide (EO) and propylene oxide (PO) chains arranged in an a-b-a triblock structure (EO-PO-EO) (32, 33). They have been included in the formulation due to their recognized ability to enhance transfection of genetic material (33-36). Because of their PEGylated surface, poloxamers offer stealth properties to the system and can be easily functionalized with different targeting moieties (37). Moreover, these polymers are approved for human administration due to their optimal water-solubility, biodegradability, and biocompatibility, as well as their low immunogenicity profile, which makes them a simple and safer approach for in vitro and in vivo gene transfection (38, 39). Several conditions and combinations have been tested to better define those which show the highest transfection efficiency and good antitumor efficacy in bioluminescent breast cancer models. Indeed, among the big challenges in cancer therapy are the avoidance of the metastatic spread of the disease, the appearance of multidrug resistance, and tumor recurrence as those features which are mostly related to the presence of CSC within a tumor (40). Arachidonate 5-lipoxygenase (ALOX5) silencing was selected as a candidate target due to its recognized key role in CSC survival and self-renewal (41). Our data show that poloxamer-PEI combinations with ALOX5-siRNA were effective in silencing ALOX5 in breast CSC and showed great therapeutic potential as anticancer treatment, significantly reducing cell malignant transformation and CSC invasion.

Materials and Methods

Materials

Different types of CS with DD of ∼86% (Protasan Ultrapure) were gently provided by NovaMatriX (USA), namely, glutamate-CS low (G113 - 160 kDa) and high (G213 - 470 kDa) MW, and hydrochloride-CS low (CL113 - 110 kDa) and high (CL213 - 270 kDa) MW. Glycol-CS was purchased from Sigma Aldrich (Madrid, Spain). Pluronic® F68, F108 and F127 were kindly provided by BASF (Ludwigshafen, Germany), while 10k branched and 25k branched PEI were provided by Alfa Aesar (Thermo Fisher GmbH, Karlsruhe, Germany) and Sigma-Aldrich (Madrid, Spain), respectively. siRNA against gree fluorescent protein (GFP-siRNA) and the scramble sequence (siC) were provided by LifeTechnologies (Spain). The sense anti-ALOX5 siRNA sequence used was 5’-CUGAGCGCAACAAGAAGAATT-3’, while a non-specific sequence, 5’-UUCUCCGAACGUGUCACGUTT-3’, was used as negative control. MDA-MB-231 (ATCC number HTB-26) cell line was obtained from American Type Culture Collection (ATCC, LGC Standards, Barcelona, Spain), and RXO-C colon cancer cells expressing GFP were generously provided by Dr. Diego Arango (CIBBIM-Nanomedicine). RPMI medium, phosphate buffered saline (PBS), and fetal bovine serum (FBS) were purchase from Lonza (Barcelona, Spain). Penicillin-streptomycin, L-glutamine, non-essential amino acids, sodium pyruvate, 0.25% Trypsin-EDTA, Lipofectamine® 2000, 4′,6-diamidino-2-phenylindole (DAPI), and LysoTracker® Red were brought from Life Technologies Ltd. (Madrid, Spain). Other reagents used were methanol, ethanol, dimethyl sulfoxide (DMSO), 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), gelatin, paraformaldehyde, Triton X-100, and 5-([4,6-dichlorotriazin-2-yl]amino)fluorescein hydrochloride (5-DTAF) from Sigma-Aldrich (Madrid, Spain), and Type 1 ultrapure water (18.2 MΩ.cm at 25 ºC, Milli-Q®, Billerica, MA, USA).

Methods

Polyplex Preparation

Polymer-siRNA complexes were prepared by simple complexation, adding the polymer solution dropwise to an equal volume of siRNA solution. The mixture was quickly vortexed during few seconds and incubated at room temperature for 30 minutes. CS-siRNA complexes were prepared at different N/P ratios calculated according to Equation 1 (mass per charge of phosphate = 330 g/mol and mass per charge of Nitrogen = 160 g/mol) and at different conditions (Table 2).

Equation 1

For the PEI-based polyplexes, two types of branched PEI, namely 10k and 25k, were used. Different N/P ratios were tested ranging from 5 to 75 (Table 4) and calculated according to Equation 1 (Considering mass per charge of phosphate = 330 g/mol and mass per charge of nitrogen = 43 g/mol).

Micelles Preparation through the Direct Dissolution Method (DM)

The amphiphilic polymer was dissolved overnight (O/N) under agitation in aqueous solution, and added dropwise to the polyplexes solution, previously prepared. After vortexing, the mixture was left to incubate for 30 minutes and filtered through a 0.22 μm syringe filter.

Micelles Preparation through the Thin-Film Hydration (FH) Technique

The amphiphilic polymers were individually weighted and dissolved in a mixture of methanol:ethanol=1:1. This mixture of solvents was chosen because the polymers are insoluble in ethanol alone (Class 3 solvent), but soluble in methanol (Class 2 solvent). By mixing both solvents it was possible to solubilize the polymers and reduce the use of methanol, as previously described. Then, the solvent was removed under vacuum and the formed film was left to dry at room temperature to eliminate any remaining solvent. Afterwards, the film was hydrated with PBS for empty micelles or with the previously prepared polymer-siRNA polyplexes and vortexed for 1 minute. The obtained dispersion was filtered through a 0.22 μm syringe filter to remove possible aggregates.

Association Efficiency (AE)

The non-associated siRNA present in the aqueous phase of the polyplexes was separated by centrifugation with filtration (10,000 rpm, 10 minutes) using a 100K membrane (Nanosep® Centrifugal Devices, Millipore, USA) and measured by spectrophotometry (Nanodrop NP-1000, Thermo Scientific, USA). AE was calculated according to Equation 2, and also assessed by agarose gel electrophoresis. Polyplexes were loaded onto 1% agarose gel with 6X loading buffer. The mixture was separated in 0.5X Tris/Borate/EDTA (TBE) buffer at 100V for 25 minutes. siRNA bands were visualized using an ultra violet imaging system (Uvidoc, UVItec Ltd, Cambridge, UK).

Equation 2

Particles Physicochemical Characterization

Particles mean hydrodynamic diameter (md) and polydispersity index (PDI) were measured by dynamic light scattering (DLS). Zeta potential was assessed by laser Doppler micro-electrophoresis using NanoZS (Malvern Instruments, UK). For each formulation, at least three batches were produced and analyzed. Particle shape and morphology were observed by transmission electron microscopy (external services from IBMC, University of Porto, Portugal).

Serum Stability

To assess the stability of formulations in the presence of serum, particles were incubated in a proportion of 1:1 with 50% FBS culture medium. Mean diameter was measured by DLS at 0, 6, 12, and 24 hours.

Cell Lines Culture Conditions

RXO-C and MDA-MB-231 breast cancer cell lines were cultured in RPMI medium supplemented with 10% FBS, 1% penicillin-streptomycin, 1% L-glutamine, 1% non-essential amino acids and 1% of sodium pyruvate. CSC subpopulation from MDA-MB-231 cell line was isolated using a model previously validated by our group (42). Briefly, the model is based on the expression of tdTomato under the control of a CSC specific promoter (ALDH1A1), which allows the separation of CSC among the bulk tumor cells population and the study of the biological efficacy of the developed therapeutic system in this subpopulation of cells. Blasticidin (0.5 mg/mL) was used as a selective antibiotic for ALDH1A1/tdTomato cell lines. All cell lines were kept at 37ºC under 5% CO2 saturated atmosphere. Cell medium was changed every other day and, upon confluence, cells were harvested from plates with 0.25% trypsin-EDTA

Cell Transfection

Different siRNA formulations were transfected into cells according to the conditions shown in Table 1. For silencing experiments, the medium was changed after 4 hours of incubation with polyplexes and PM-polyplexes. For the toxicity assays, cells were left 24 hours in contact with formulations, while for internalization assays, cells were incubated over 4 hours. Cells were harvested 24 to 72 hours after transfection. For internalization experiments, particles were diluted at a ratio of 1:10. Lipofectamine® 2000 was used as positive control for transfection according to suppliers’ protocols and in order to obtain a final siRNA concentration in the well of 200 nM. For all experiments, cells were transfected at the same conditions using a scrambled siRNA sequence (siC).

Table 1. Transfection Conditions for the Different Experiments

Day 0: before transfection

Day 1: during transfection time (4 hours)

Plates

Cells seeded (cells/well)

Volume of medium (µl)

Volume of medium

(µl)

Volume of formulation

(µl)

Final siRNA concentration (nM)

96 well

5.0×103

100

50

50

200

24 well

5.0×104

1000

100

100

200

6 well

2.0×105

2000

250

250

200

GFP Reporter Gene Silencing Assay

RXO-C cancer cells expressing GFP were used as a model to assess the silencing efficacy of the different nanosystems. Polyplexes and micelles prepared using a GFP-siRNA and different cationic polymers were transfected to cells previously seeded in 96 well plates. Complexes formed between Lipofectamine® 2000 and GFP-siRNA were used as positive controls. The expression of GFP in cells after transfection was assessed with fluorescence microscopy (Olympus, USA). The intensity of cells fluorescence was also measured using an FLX800 Fluorescent Microplate Reader (BioTek, Germany).

In vitro Cytotoxicity Assay

The cytotoxicity of different components was assessed in MDA-MB-231 breast cancer cells using the MTT assay. Briefly, cells previously seeded in 96-well plates were incubated in the presence and absence of increasing concentrations of polymers/formulations for 24 hours. After the incubation time, medium was changed, and cells left for additional 72 hours. Complete medium was used as negative control and 10% DMSO as positive control of toxicity. After 72 hours of incubation, 0.5 mg/mL of MTT was added to each well. Plates were incubated for additional 4 hours at 37ºC, the medium discarded, and the formazan crystals produced by mitochondrial succinate dehydrogenase dissolved with DMSO. The absorbance of each well was read on a microplate reader (ELx800 absorbance reader, BioTek, Germany) at 590 nm and cell viability calculated accordingly. Cell viability data were used to determine IC50 value by nonlinear regression of the dose-effect curve fit, using Prism 6.02 software (GraphPad Software, Inc., CA, USA).

Conjugation of F127 with 5-DTAF

F127 was fluorescently conjugated with 5-DTAF in an aqueous medium via nucleophilic aromatic substitution by an addition-elimination pathway, as previously described.44 Briefly, a stock solution of 20 g/L 5-DTAF in DMSO was diluted in 0.1M sodium bicarbonate (pH 9.3) and added to a 6% (w/v) F127 solution in 0.1M sodium bicarbonate (pH 9.3) to a final molar ratio of 1:2 (F127:5-DTAF). The reaction was left overnight in the dark, at room temperature. Unreacted 5-DTAF was washed out by dialysis (12,000–14,000 MWCO Spectra/Por® membrane from Spectrum Europe BV, The Netherlands) against type I ultrapure water. Dialyzed polymer solutions were lyophilized and stored in closed containers protected from light (Virtis Benchtop Freeze Dryer, SP Scientific).

Internalization Assays

Flow cytometry and confocal microscopy were used to assess quantitatively and qualitatively the internalization capacity of the nanosystem into MDA-MB-231 breast cancer cells. For quantitative Fluorescence-activated cell sorting (FACS) assays, 2×105 cells were seeded in 6 well plates and incubated for 24 hours. After incubation, 5-DTAF-labelled micelles were added to cells and incubated for 4 hours, and washed with 1× PBS, detached with 0.25% trypsin-EDTA, and re-suspended in PBS supplemented with 10% FBS. Cells were then stained with DAPI (1 μg/mL). Plates were analyzed in a Fortessa cytometer (BD Biosciences, San Jose, California, USA). Data were analyzed with FCS Express 4 Flow Research Edition software (De Novo Software, Los Angeles, USA). Contaminants were removed by forward and side scatter gating. For each sample, at least 10000 individual cells were collected to measure mean fluorescence intensity. For qualitative confocal microscopy assay (Spectral Confocal Microscope MFV1000 Olympus, USA), cells were cultured in 0.1% gelatin-treated coverslips at a density of 2.5×105 cells per well in 6 well plates. After 24 hours, cells were incubated with 5-DTAF labelled-PM for 4 hours, and further incubated for 30 minutes with LysoTracker® Red. Subsequently, cells were fixed using 4% paraformaldehyde. Finally, nuclei were stained with DAPI (0.2 mg/mL) for 5 minutes in the dark and further visualized.

Cell sorting

FACS was used to sort CSC and non-CSC subpopulations from a heterogeneous population MDA-MB-231 cells. For cell sorting, a starting amount of 5×106 cells was used. Cells were detached with 0.25% trypsin-EDTA and re-suspended in PBS supplemented with 10% FBS and DAPI (1 μg/mL) used for vital staining. Cells were sorted according to tdTomato expression and DAPI staining in a FACS Aria cell sorter (BD Biosciences, Madrid, Spain). Sorted cells were collected in complete medium without antibiotic and stored.44

RNA Extraction and Quantitative RT-PCR (qRT-PCR)

Total RNA was extracted from cells using RNeasy Micro Kit (Qiagen, Madrid, Spain). RNA was reverse transcribed with High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Madrid, Spain) according to manufacturer instructions. The cDNA reverse transcription product was amplified with specific primers for ALOX5 (hALOX5 F: 5’ AGAACCTGGCCAACAAGATTGT A 3’; hALOX5 R: 5’ TCTGGTGGACGTGGAAGTCA 3’) GADPH (hGADPH F: 5’ ACC CAC TCC TCC ACC TTT GAC; hGADPH R: 5’ CAT ACC AGG AAA TGA GCT TGA CAA 3’) andActin (hActin F: 5’ CAT CCA CGA AAC TAC CTT CAA CTC C 3’; hActin R: 5’GAG CCG CCG ATC CAC AC 3’) by qPCR using the SYBR Green method. The reaction was performed in triplicate in a 7500 Real-Time PCR system (Applied Biosystems, Madrid, Spain). Actin and GADPH, were used as endogenous controls. Relative mRNA levels were calculated using the comparative Ct method (2e- ΔΔCt).

Cell Transformation Assay (Anchorage-Independent Growth Assay)

Anchorage-independent growth of the different breast cancer cell lines was assessed by CytoSelect™ Cell Transformation Assay Kit (Cell Biolabs, San Diego, CA, USA). A semisolid agar media was prepared according to manufacturer prior addition of PM-siALOX5 or PM-siC to each well. After 6–8 days of incubation, colonies were observed under optical microscopy and viable transformed cells counted using trypan blue.

Invasion Assay

Cells invasiveness was assessed using CytoSelect™ Laminin Cell Invasion Assay Kit (Cell Biolabs, San Diego, CA, USA) accordingly to manufacturer instructions. Briefly, inserts were placed in 24 well plates and 2.5×104 cells previously transfected (24 hours before) with PM-siALOX5 and PM-siC, added to the upper chamber. After 48 hours incubation, invasive cells were dissociated from the membrane, lysed, and quantified with CyQuant® GR Fluorescent Dye using an FLX800 Fluorescent Microplate Reader (BioTek, Germany).

Statistical Analysis

At least three batches from each polyplex and PM were produced and characterized, and results expressed as mean±standard deviation (SD). For biological studies, at least 3 replicates, each involving at least two technical replicates, were involved. Final results were also expressed as mean±SD. Statistical analysis was performed in Microsoft Office Excel™ 2010 using unpaired Student's t-test. Differences were considered as statistically significant when p-values were smaller than 0.05.

Results

CS-Based Systems

Due to known advantages of CS and its derivatives for gene delivery, a screening for the best CS polyplexes with optimal transfection conditions was performed. GFP silencing efficacy of different conditions and combinations were also tested (Table 2). For all CS showing high AE in vitro cytotoxicity was also assessed.

Figure 1. A, In vitro cytotoxicity of CS-siRNA polyplexes at different N/P ration in MDA-MB-231 cells. B, Polyplexes association efficiency. The graph represents the concentration of free siRNA detected in the supernatant by spectrophotometry after formulation filtration by centrifugation using different N/P ratios. Agarose gel electrophoresis for the CL213-based polyplex. 1 – free siRNA; 2 – 1:10 ratio; 3 – 1:5 ratio; 4 – 1:2.5 ratio; 5 – 1:1 ratio. Free siRNA was observed in siRNA:CS ratio of 5:1 (encircled).

According to our data, all CS were able to efficiently complex with siRNA (Figure 1A). A decrease in the concentration of free siRNA was observed upon complexation with CS even at low ratios. Additionally, in the agarose gel assay, a small amount of free siRNA was only detected in CS:siRNA 1:1 ratio. Nonetheless, low N/P ratios are not enough to produce biological efficacy, thus higher N/P ratios were further tested in terms of cell toxicity. Figure 1B demonstrates that CL113, G113, CL213 and G213 have a similar toxicity pattern, being an N/P ratio of 80 the maximum N/P ratio that can be used without causing severe toxicity. Glycol-CS causes higher toxicity even at lower N/P ratios.

Table 2. Summary of the Different Conditions Tested on CS-Based Polyplexes

Tested Conditions

Observations

siRNA final conc. in the well

50 nM

No effect

100 nM

No effect

200 nM

Effective (at certain conditions)

Polyplexes

Glycol-CS

Toxic (at ratios > 60)

G113

No effect

CL113

No effect

G213

Effective (at certain conditions)

CL213

Effective (at certain conditions)

N/P ratios

<10

No effect

20

No effect

30

No effect

40

No effect

60

No effect

80

Knockdown detected (at certain toxicity)

100

Toxicity

>100

Highly toxic

pH

4.5 (in acetate buffer)

Higher efficacy

7 (in water)

Low effect

Time-points

24 hours

No effect

48 hours

No effect

72 hours

Knockdown detected

Micelles

CL213 (N/P 80, pH 4.5) + F127 (1%)

Time-point 72 hours

Effect < than Lipofectamine® 2000

As described in Table 2, the most promising polyplexes, such as those able to cause a visible decrease in the number of cells expressing GFP without promoting significant toxicity, were obtained with the following conditions: GFP-siRNA at a final concentration of 200 nM per well, complexed with CL213 and G213 CS at a N/P ratio of 80 and pH 4.5, observed in a post-transfection incubation time of 72 hours.

Results depicting the silencing efficacy of CL213-based GFP-siRNA polyplexes produced at optimal conditions, are showed in Figure 2A. A partial silencing of the expression of GFP at 72 hours after transfection, was observed. Nonetheless, a significantly stronger silencing was observed in cells transfected with Lipofectamine® 2000. On the contrary, no decrease of GFP expression was observed in cells transfected with siC. Similar results were obtained with the polyplexes composed by G213. No significant silencing efficacy was observed with other types of CS tested. CS-siRNA polyplexes produced with CL213-CS were further characterized resulting in 17nm size, positive charge (+ 15 mV) and spherical shape (Table 3).

Table 3. Physicochemical Characterization of Polyplexes using CL213 CS

Parameters

CL113-CS polyplexes

Md (nm)

16.6 ± 0.8

PDI

0.19 ± 0.07

Zp (mV)

+15.2 ± 1.7

Md = mean diameter; PDI = polydispersity index; Zp = Zeta potential. Md, PDI, and Zp values for Cs-siRNA polyplexes are expressed as mean±SD, n=3.

Table 4. Physicochemical Characterization of Different Pluronic®-Based Micelles

Polymer

Md (nm)

PDI

Zp (mV)

IC50 (mg/mL)

F68

228.6 ± 31.2

0.5 ± 0.2

2.9±1.0

n.d.

F108

130.2 ± 18.4

0.4 ± 0.2

2.1±1.2

>10

F127

68.5 ± 9.4

0.2 ± 0.1

2.7±1.8

>10

Md=Mean diameter; PDI=polydispersity index; Zp=Zeta potential. Md, PDI and Zp values for polyplexes Cs-siRNA are expressed as mean±SD, n=3.

Different Pluronic®-based PM obtained by direct DM were tested with the objective to ensure protection of the siRNA sequence and to increase the biological efficacy of these polyplexes. All micelles presented sizes under 250 nm (lower than 75 nm for Pluronic® F127) and nearly a neutral surface charge (Table 4).

Due to high polydispersity and low reproducibility of micelles obtained with F68, this polymer was discarded from the further studies. Regarding cytotoxicity assessment, both Pluronic® F108 and F127 presented IC50 higher than 10 mg/mL (Table 4). Because Pluronic® F127 micelles showed the smallest size and lowest polydispersity, it was selected to produce micelles combined with CL213-CS-based polyplexes (CS-siRNA-Pluronic®). In the biological assessment, we observed better silencing of GFP expression from CS-siRNA-Pluronic®-polyplexes compared to CS-polyplexes (Figure 2B). Conversely, no silencing was noticed in cells transfected with siC. However, despite the improvement in gene silencing promoted by the presence of Pluronic® F127, silencing efficacy of this system is still lower than the one obtained using Lipofectamine® 2000, as positive control.